|  Help  |  About  |  Contact Us

Allele : Rr598<em3Yagk> regulatory region 598; endonuclease-mediated mutation 3, Yana G Kamberov

Primary Identifier  MGI:7856495 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr598
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The En1 enhancer, located downstream in an intron of Celrr, was targeted using sgRNAs (equivalent to CAGAATCAATATAAGCCCCAGGG and TTCTTCCGGACCATGGACTAGGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the replacement of mouse enhancer sequence (GRCm39:chr1:121024493-121025555) with the equivalent human enhancer sequence (GRCh38:chr2:118309555-118310531).
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • hECE18<KI>,
  • hECE18<KI>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories