| Primary Identifier | MGI:7856495 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr598 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The En1 enhancer, located downstream in an intron of Celrr, was targeted using sgRNAs (equivalent to CAGAATCAATATAAGCCCCAGGG and TTCTTCCGGACCATGGACTAGGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the replacement of mouse enhancer sequence (GRCm39:chr1:121024493-121025555) with the equivalent human enhancer sequence (GRCh38:chr2:118309555-118310531). |
