| Primary Identifier | MGI:7856727 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr545 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Taar enhancer TE2, located between Taar6 and Taar7a, was targeted using sgRNAs (targeting GTAAATAAAAACTTTCCCTC, CTCCATCGTCACAAAGCCTG, CCCTCAAAAAGTTTGTTTTT and CAGGTCTTTTTTAGTGGACT) with CRISPR/Cas9 technology, resulting in a 1433 bp deletion (GRCm39:chr10:23863270-23864702). This leads to the reduction in expression of a number of Taar genes without affecting olfactory gene expression. |
