|  Help  |  About  |  Contact Us

Allele : Rr545<em1Qli> regulatory region 545; endonuclease-mediated mutation 1, Qian Li

Primary Identifier  MGI:7856727 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr545
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Taar enhancer TE2, located between Taar6 and Taar7a, was targeted using sgRNAs (targeting GTAAATAAAAACTTTCCCTC, CTCCATCGTCACAAAGCCTG, CCCTCAAAAAGTTTGTTTTT and CAGGTCTTTTTTAGTGGACT) with CRISPR/Cas9 technology, resulting in a 1433 bp deletion (GRCm39:chr10:23863270-23864702). This leads to the reduction in expression of a number of Taar genes without affecting olfactory gene expression.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • TAAR enhancer 2 -,
  • TAAR enhancer 2 -
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele