|  Help  |  About  |  Contact Us

Allele : Iho1<em1Atot> interactor of HORMAD1 1; endonuclease-mediated mutation 1, Attila Toth

Primary Identifier  MGI:7857221 Allele Type  Endonuclease-mediated
Attribute String  Altered localization Gene  Iho1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6JCrl
Is Recombinase  false Is Wild Type  false
molecularNote  CRISPR/cas9 mediated recombination using a guide RNA (GGATTTTGATAGCAGCGATGATA) resulted in the insertion of a T causing a frameshift and premature stop codon. The resulting protein lacks the last 7 amino acids. Testicular expression levels of the truncated protein are similar to wild-type protein expression; however, protien is depleted from the chromatin-enriched fractions of testis extracts.
  • mutations:
  • Single point mutation
  • synonyms:
  • Iho1<C7delta>,
  • Iho1<C7delta>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories