| Primary Identifier | MGI:7857221 | Allele Type | Endonuclease-mediated |
| Attribute String | Altered localization | Gene | Iho1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6JCrl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/cas9 mediated recombination using a guide RNA (GGATTTTGATAGCAGCGATGATA) resulted in the insertion of a T causing a frameshift and premature stop codon. The resulting protein lacks the last 7 amino acids. Testicular expression levels of the truncated protein are similar to wild-type protein expression; however, protien is depleted from the chromatin-enriched fractions of testis extracts. |
