|  Help  |  About  |  Contact Us

Allele : Rr593<em1Emta> regulatory region 593; endonuclease-mediated mutation 1, Emmanouil Tampakakis

Primary Identifier  MGI:7852482 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr593
Strain of Origin  (C57BL/6 x SJL)F2 Is Recombinase  false
Is Wild Type  false
molecularNote  The Actn2 enhancer was targeted using sgRNAs (equivalent to GCCAGGCCTGATGGACCTC and ACTGATGGGCTAGTATGATC) with CRISPR/Cas9 technology, resulting in its deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Actn2 enh del,
  • Actn2 enh del
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele