| Primary Identifier | MGI:7859265 | Allele Type | Endonuclease-mediated |
| Attribute String | Reporter | Gene | Tnnt2 |
| Transmission | Germline | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A sgRNA (TTTCATCTATTTCCAACGCC) was designed to target the C-terminal of the troponin T2, cardiac (Tnnt2) gene with a virus-derived T2A self-cleaving sequence that mediates ribosomal skipping fused to an enhanced green fluorescent protein (EGFP) sequence. sgRNA, donor plasmid, and the Cas9 RNA were electroporated into the cytoplasm of C57BL/6N-derived embryonic stem (ES) cells. |
