|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em1(CAG-rtetR,-Zfp354a*)Rudl> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Christiane Ruedl
Primary Identifier  MGI:7852266 Allele Type  Endonuclease-mediated
Attribute String  Inserted expressed sequence, Transactivator Gene  Gt(ROSA)26Sor
Transmission  Germline Strain of Origin  129S6/SvEvTac
Is Recombinase  false Is Wild Type  false
molecularNote  By CRISPR-cas9 technology, (from 5' to 3') a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a reverse tetracycline repressor (rTetR), a nuclear localization sequence, and the transcriptional-repressing KRAB domain from zinc finger protein 354A (Zfp354a) gene followed by a polyadenylation sequence was inserted into Gt(ROSA)26Sor locus. rTetR was cloned from rtTA lacking the VP16 domain. The minimal KRAB domain spans amino acids 12 to 53 of the Zfp354a gene. A sgRNA (GACTGGAGTTGCAGATCACG) designed to target the Gt(ROSA)26Sor locus (based on Gt(ROSA)26Sor ENSMUST00000332437.1) was used to insert this Rosa26-rTetR-KRAB cassette via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells.
  • mutations:
  • Insertion
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories





MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom