| Primary Identifier | MGI:7852266 | Allele Type | Endonuclease-mediated |
| Attribute String | Inserted expressed sequence, Transactivator | Gene | Gt(ROSA)26Sor |
| Transmission | Germline | Strain of Origin | 129S6/SvEvTac |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | By CRISPR-cas9 technology, (from 5' to 3') a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a reverse tetracycline repressor (rTetR), a nuclear localization sequence, and the transcriptional-repressing KRAB domain from zinc finger protein 354A (Zfp354a) gene followed by a polyadenylation sequence was inserted into Gt(ROSA)26Sor locus. rTetR was cloned from rtTA lacking the VP16 domain. The minimal KRAB domain spans amino acids 12 to 53 of the Zfp354a gene. A sgRNA (GACTGGAGTTGCAGATCACG) designed to target the Gt(ROSA)26Sor locus (based on Gt(ROSA)26Sor ENSMUST00000332437.1) was used to insert this Rosa26-rTetR-KRAB cassette via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells. |