|  Help  |  About  |  Contact Us

Allele : Rr592<em1Rnis> regulatory region 592; endonuclease-mediated mutation 1, Riko Nishimura

Primary Identifier  MGI:7852298 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr592
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The chondrocyte-specific Sox9 enhancer, located upstream, was targeted using sgRNAs (equivalent to TGCTAGGAGACTCGTCAATGGGG, CCTTCTCCAAGGTGGATTTCATG, CCTTTGGATTCCCTACCCACATG and CCACATGTGATAGATTAGACATA) with CRISPR/Cas9 technology, resulting in a deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • E308<delta>,
  • E308<delta>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories