| Primary Identifier | MGI:7852299 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr592 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The chondrocyte-specific Sox9 enhancer, located upstream, was targeted using sgRNAs (equivalent to TGCTAGGAGACTCGTCAATGGGG, CCTTCTCCAAGGTGGATTTCATG, CCTTTGGATTCCCTACCCACATG and CCACATGTGATAGATTAGACATA) with CRISPR/Cas9 technology, resulting in a deletion. This allele was created in zygotes that are homozygous for the Rr337em1Rnis allele. |