| First Author | Endo Y | Year | 1996 |
| Journal | Genomics | Volume | 38 |
| Issue | 1 | Pages | 92-5 |
| PubMed ID | 8954786 | Mgi Jnum | J:36979 |
| Mgi Id | MGI:84385 | Doi | 10.1006/geno.1996.0598 |
| Citation | Endo Y, et al. (1996) Structure and chromosomal assignment of the human cyclin G gene. Genomics 38(1):92-5 |
| abstractText | Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia. |