| First Author | Blair HJ | Year | 1994 |
| Journal | Mouse Genome | Volume | 92 |
| Issue | 3 | Pages | 511-12 |
| Mgi Jnum | J:20789 | Mgi Id | MGI:68859 |
| Citation | Blair HJ, et al. (1994) Tfe3 maps close to Gata1 on the mouse X Chromosome. Mouse Genome 92(3):511-12 |
| abstractText | Full text of Mouse Genome contribution: Tfe3 maps close to Gata1 on the mouse X chromosome. Helen J. Blair and Yvonne Boyd; Genetics Division, MRC Radiobiology Unit, Chilton, Didcot, Oxon OX11 ORD. Transcription factor 3 (TFE3) binds specifically to the uE3 site of the immunogIobulin heavy chain enhancer (1). Human and murine cDNAs for TFE3 have been cloned and have been shown to lie on the X chromosomes of man and mouse (1,2). In man, TFE3 lies in the proximal region of the human X chromosome short arm (Xp) close to GATA-binding protein 1 (GATA1) in Xp11.23 (3). Gatal has been positioned between Cybb and DXHXF34 on the mouse X chromosome using interspecific backcross analysis and uniquely defines a region of homology between the human and mouse X chromosomes (4). In the mouse, Tfe3 has been placed in band XA2 by in situ hybridisation and could lie in any one of three chromosomal segments conserved between mouse and man (2, 5). To position Tfe3 with respect to other markers in the region and thereby within a conserved segment, we have designed primers from the 3' untranslated region (UTR) of the published murine sequence and identified RFLVs between Mus musculus and Mus spretus. These RFLVs have been used to map Tfe3 using two well-characterised interspecific backcrosses which have been described previously (6). The 3' UTR primer sequences 5' TAAGGGTATGCCCCTGGCCAC 3' and 5' AAGGTCAGCACAGAGTCCTCA 3' define an amplification product of 455 bp equivalent to nucleotides 1618 - 2073 of the cDNA sequence published by Roman et al. (2). Using these primers, products of this size were amplified from DNA prepared from Mus musculus (C3H/HeH, 101/H, BALB/c, C57BL/6J, CBA/H, 129, JU, PT), Mus castaneus and Mus spretus. When these products were digested with Hhal, all DNAs except for Mus spretus yielded two products of 267bp and 188bp, indicating that during the divergence of Mus spretus from Mus musculus a sequence change had occurred which resulted in the loss of this Hhal site. Therefore by amplification of DNAs and subsequent Hhal digestion, we could type interspecific backcross panels constructed between Mus musculus (3H1, F1 hybrid between C3H/HeH females and 101/H males) and Mus spretus for RFLVs at Tfe3 (Figure 1). Figure 1. (Legend) RFLVs at Tfe3 detected by Hhal digestion of PCR amplification products in Mus musculus (M, 3H1) and Mus spretus (S) and a representative selection of interspecific backcross animals ([3H1xMus spretus]Fl female x 3H1 male); backcross female can be MM or MS, backcross male M or S. Digested amplification products of 276bp and 188bp observed in 3H1 and of 455bp observed in Mus spretus are arrowed. Products were amplified from 50ng of template DNA in a standard PCR buffer (1.5mM MgCl2) using an annealing temperature of 62 degrees C. The data from both backcrosses have been combined as no significant difference was found between the two sets of data. The mapping was performed in two stages. Firstly, Tfe3 was positioned in the proximal region of the mouse X chromosome and the order of, and genetic distances (in cM) between, loci established as DXWas70 - (3.0 +/- 1.3) - Tfe3 - (3.9 +/- 1.4) - Pfc (166 animals typed for DXWas70 and Tfe3, 177 animals typed for Tfe3 and Pfc). These data confirmed that Tfe3 lay in XA2 as DXWas70 and Pfc have been positioned in XA2 and proximal XA3 by in situ hybridisation respectively (7,8). Secondly, Tfe3 was positioned with respect to other markers in the DXWas70 - Pfc interval by pedigree analysis of selected recombinants from both backcrosses and the order (DXWas70, DXHXF34) - DXMit26 - (Gata1, Tfe3) - Cybb - Otc established (Figure 2). Figure 2. (Legend) The position of Tfe3 on the genetic map of the proximal region of the mouse X chromosome (left) and the cytogenetic map of the proximal region of the human X chromosome short arm (right). Arrows indicate the approximate positions of evolutionary breakpoints. Details of other loci can be found in ref. 9 (mouse) and ref. 3 (man). Thus Tfe3 lies close to Gata1 on both the human and mouse X chromosomes and is the second marker to define this small block of homology which lies between PFC and DXS423 on the human X chromosome and DXHXF34 and Cybb on the mouse X chromosome. Acknowledgements. We thank the RBU photography department for assistance. This work was supported in part by the HGMP directed programme. 1. Beckman et al. (1990) Genes and Development 4: 167-179. 2. Roman et al. (1992) Mol. Cell Biol. 12: 817-827. 3. Shlessinger et al. (1993) Cytogenet. Cell Genet. 64: 147-170. 4. Laval and Boyd (1993) Mamm. Genome 4: 119-123. 5. Blair et al. (1994) Genomics 19: 215-220. 6. Blair et al. (1993) Mamm. Genome 4: 230-233. 7. Fisher and Tease (1992) Mouse Genome 90: 430-431. 8. Evans et al. (1991 ) Genet. Res. 56: 153-155. 9. Brown et al. (1993) Mamm. Genome 4: 269-281. |
