| First Author | Taylor BA | Year | 1993 |
| Journal | Mouse Genome | Volume | 91 |
| Issue | 1 | Pages | 134-36 |
| Mgi Jnum | J:4282 | Mgi Id | MGI:52778 |
| Citation | Taylor BA, et al. (1993) Mapping of a Pit-1 PCR-RFLV in recombinant inbred strains. Mouse Genome 91(1):134-36 |
| abstractText | Full text of Mouse Genome contribution: MAPPING OF A Pit-1 PCR-RFLV IN RECOMBINANT INBRED STRAINS. Benjamin A. Taylor1, Salmo Raskin2, and John A. Phillips III2; 1 The Jackson Laboratory, Bar Harbor, ME, 2Vanderbilt University, Nashville TN. INTRODUCTION Mutations in the murine pituitary specific transcription factor-1 (Pit-1) gene cause panhypo- pituitary dwarfism in the Snell (dw) and dwJ dwarf mice1. The Pit-1 gene encodes a transcription factor essential for function of anterior pituitary cells that secrete growth hormone, prolactin and thyroid stimulating hormone. To provide a convenient DNA marker for the Pit-1 gene and to map its location we identified restriction fragment length variants in a segment of the gene amplified by the polymerase chain reaction (the PCR-RFLV method)2, 3. Typing recombinant inbred strains in this way enabled us to determine the map order of Pit-1 in relationship to flanking loci. MATERIALS AND METHODS DNA Analysis. One ul (400 ng) of mouse genomic DNA from each strain was added to a 100 u1 reaction containing 50 picomoles of each oligonucleotide primer; 10mM Tris (pH 8.0); 50 mM KC1; 1.5 mM MgCl, 0.001% gelatin and 200 uM of each deoxynucleotide triphosphate4. The contents of each reaction were denatured at 96 degrees C for 5 min in a Perkin Elmer Cetus Thermocycler, and 2 units of Taq polymerase were then added. Next, 30 cycles of PCR amplification consisting of 94 degrees C for 60 sec, 57 degrees C for 120 sec and 72 degrees C for 150 sec were done followed by a 10 min extension period at 72 degrees C, and the products were cooled on ice. Forty ul aliquots of each reaction were then digested with various restriction enzymes (2 units) at 37 degrees C for 2 hr. DNA fragments were separated by electrophoresis in 5% polyacrylamide gels in 1X TBE (Tris-Borate-EDTA, pH 8.0) for 3 hr at 200 mV, and the PCR products were stained with ethidium bromide and viewed under UV light. Genetic Mapping. Recombinant inbred strains of mice were used for mapping. Recombination frequencies between loci were estimated using the equation r = R/(4 - 6r), where r is the recombination frequency and R is the observed proportion of RI strains with recombinant genotypes at any pair of loci5. Confidence intervals for the estimated recombination frequencies were obtained from a published table6. The likelihoods of alternative gene orders were calculated by the method of Neumann7. RESULTS PCR primers were synthesized from conserved regions that flank intron 3 [5'GGTGGAAGAGCCAATAGACATGGAC3' (upstream) and 5'CCACGTTTGTCTGGGTGTATCCT3' (downstream)]. These sequences were selected based on the published mouse Pit-1 cDNA sequence and correspond to nucleotides 351-375 and 460-437, respectively1. These primers were used to amplify intron 3 of the Pit-1 gene from genomic DNA of progenitor mouse strains and PCR-RFLVs were detected by restriction digestion and polyacrylamide electrophoresis of the amplified products. The amplification products of eight inbred strains were analyzed for intron 3 PCR-RFLVs. RI progenitor strains AKR/J, BALB/cByJ, C3H/HeJ, C57BL/6J, DBA/2J, SJL/J and SWR/J exhibited a common pattern of restriction fragments with all enzymes used. Genetic variants were detected in the C57L/J strain using either DraI or MnlI. These DraI and MnlI PCR-RFLV marking the Pit-1 gene was typed in 18 AKXL RI strains derived from the cross of AKR/J and C57L/J, and in 7 SWXL RI strains derived from the cross of SWR/J and C57L/J. Comparison of the Pit-1 strain distribution pattern (SDP) with that of previously defined Chr 16 markers in the AKXL RI strains revealed clear linkage with the DNA marker Dl6Ros2 (0/18 recombinants), with the xenotopic proviral locus Xmv-35 (1/18 recombinants) and with the polytropic proviral locus Pmv-14 (2/18 recombinants) (Table 1). There are six recombinants with the more proximal loci Mpmv-17 and Ck-4, that share a common SDP, and five recombinants with D16Ros1. The estimated recombination frequencies (and 95% confidence limits) between Pit-1 and the other closely linked loci are as follows: Dl6Ros2, 0.0 (<0.050) Xmv-35, 0.015 (0.0004, 0.12), Pmv-14 (and D21S52h), 0.033 (0.0035, 0.18). The gene order (proximal to distal) that minimizes the number of recombinants is D16Ros1, (Pit-1, D16Ros2), Xmv-35, Pmv-14. No double crossovers need be postulated with this gene order. The gene order Pit-1 - Xmv-35 - (Pmv-14, D21S52h) is 9.1 times more likely than either of the alternative gene orders. Four SWXL RI strains (SWXL-4, -14, -16, and -17) inherited the SWR/J allele, while three (SWXL-7, -12, and -15) inherited the C57L/J allele. This is the first Chr 16 SDP to be published for the SWXL RI strains. DISCUSSION The present results demonstrate the feasibility of combining PCR and RFLV analysis for detecting genetic differences between conventional RI strains. Although Southern blot analysis has been used for detecting Pit-1 restriction fragment variants among Mus subspecies, no polymorphism among conventional inbred strains has been reported. Previously, Pit-1 has been mapped with respect to several other Chr 16 markers in intersubspecific and interspecific backcrosses(8-11). However, the closest of these markers was D21S16h, which showed 8.4 % recombination with Pit-1. Our data suggest that D16Ros2, Xmv-35 and Pmv-14 may all be closer to Pit-1. The present results are consistent with the placement of Xmv-35 and Pmv-14 based on previously reported RI and backcross results. The present Pit-1 SDP provides a valuable anchor locus for Chr 16 in both the AKXL and SWXL RI strains. It is of interest that mice of the C57L/J strain, which are relatively small and frequently infertile, carry a rare allele of the Pit-1 gene. Since 9 of the 18 AKXL RI strains and 3 of 7 SWXL RI strains have become fixed for the C57L/J Pit-1 allele, it is unlikely that Pit-1 is a major determinant of the reduced fertility of the C57L/J strain. Likewise, there is no apparent relationship between body size and the inheritance of Pit-1 alleles in the AKXL RI strains (data not shown). The PCR-RFLV method is a potentially useful method for detecting inter-strain differences, but it has only been rarely applied to mouse gene mapping12. Acknowledgments. This work was supported in part by NIH Grants GM18684, HD28819, and RR00095. REFERENCES 1. Li, S., et al. Nature 347, 528-33 (1990). 2. Nomura, N., et al. Transplant Proc 23, 431-3 (1991). 3. Phillips, J.A., III, et al. Prog Abstr 74th Ann Mtng Endocrine Soc 254 (1992). 4. Saiki, R.K., et al. Science 239, 487-491 (1988). 5. Taylor, B.A. in Origins of Inbred Mice (eds. Morse, H.C., III) 423-438, Academic Press, New York, (1978). 6. Silver, J. J. Hered. 78, 436-440 (1985). 7. Neumann, P.E. Genetics 128, 631-638 (1991). 8. Reeves, R.H., O'Hara, B.F., Pavan, W.J., Gearhart, J.D. & Haller, O. J Virol 62, 4372-4375 (1988). 9. O'Hara, B.F., et al. Mol Brain Res 4, 283-292 (1988). 10. Camper, S.A., Saunders, T.L., Katz, R.W. & Reeves, R.H. Genomics 8, 586-590 (1990). 11. Warden, C.H., Diep, A., Taylor, B.A. & Lusis, A.J. Genomics 12, 851-852 (1991). 12. Steinhelper, M.E. & Field, L.J. Genomics 12, 177-179 (1992). 13. Frankel, W.N., Stoye, J.P., Taylor, B.A. & Coffin, J.M. J Virol 63, 3810-3821 (1989). 14. Frankel, W.N., Stoye, J.P., Taylor, B.A. & Coffin, J.M. Genetics 124, 221-236 (1990). 15. Cho, M., Villani, V. & D'Eustachio, P. Mammal Genome 1, 30-36 (1991). 16. Ratty, A.M., Matsuda, Y., Elliott, R.W., Chapman, V.M. & Gross, K.W. Mammal Genome 3, 5-10 (1992). 17. Frankel, W.N., Stoye, J.P., Taylor, B.A. & Coffin, J.M. J Virol 63, 1763-1774 (1989). 18. Cheng, S.V., et al. Proc Natl Acad Sci USA 85, 6032-6 (1988). Table 1. (Legend). Inheritance of Chr 16 Markers in the AKXL Recombinant Inbred Strains AKXL Locus: Pmv-32; 5: Aa; 6: La; 7: L; 8: ; 9: A; 1/2: L; 1/3: A; 1/4: L; 1/6: L; 1/7: A; 1/9: A; 2/1: A; 2/4: A; 2/5: L; 2/8: A; 2/9: A; 3/7: L; 3/8: A; Reference: 13. Locus: Mpmv-17, Ck 4; 5: A; 6: A; 7: L; 8: L; 9: A; 1/2: A; 1/3: A; 1/4: L; 1/6: L; 1/7: L; 1/9: A; 2/1: A; 2/4: L; 2/5: L; 2/8: L; 2/9: A; 3/7: A; 3/8: L; Reference: 14, 15. Locus: D16Ros1; 5: A; 6: L; 7: L; 8: L; 9: A; 1/2: A; 1/3: A; 1/4: L; 1/6: L; 1/7: L; 1/9: A; 2/1: A; 2/4: L; 2/5: L; 2/8: L; 2/9: A; 3/7: A; 3/8: L; Reference: l 6. Locus: Pit-1, D16Ros2; 5: A; 6: L; 7: L; 8: L; 9: A; 1/2: A; 1/3: L; 1/4: L; 1/6: A; 1/7: L; 1/9: A; 2/1: L; 2/4: L; 2/5: A; 2/8: A; 2/9: A; 3/7: A; 3/8: L; Reference: 9. Locus: Xmv-35; 5: A; 6: L; 7: L; 8: L; 9: A; 1/2: A; 1/3: L; 1/4: L; 1/6: A; 1/7: L; 1/9: A; 2/1: L; 2/4: L; 2/5: A; 2/8: A; 2/9: A; 3/7: A; 3/8: A; Reference: 17. Locus: Pmv-14, D21S52h; 5: A; 6: L; 7: L; 8: L; 9: L; 1/2: A; 1/3: L; 1/4: L; 1/6: A; 1/7: L; 1/9: A; 2/1: L; 2/4: L; 2/5: A; 2/8: A; 2/9: A; 3/7: A; 3/8: A; Reference: 13, 18. Locus: Sod-1; 5: A; 6: A; 7: A; 8: L; 9: L; 1/2: A; 1/3: L; 1/4: A; 1/6: A; 1/7: A; 1/9: A; 2/1: L; 2/4: L; 2/5: A; 2/8: L; 2/9: L; 3/7: A; 3/8: A; Reference: 18. aThe letters 'A' and 'L' are used as generic symbols to denote alleles inherited from the progenitor strains AKR/J and C57L/J, respectively. |
