| First Author | Sanders S | Year | 1996 |
| Journal | Mouse Genome | Volume | 94 |
| Issue | 4 | Pages | 880-882 |
| Mgi Jnum | J:38088 | Mgi Id | MGI:85477 |
| Citation | Sanders S, et al. (1996) A Glucose-6-Phosphate Dehydrogenase (G6PD) pseudogene in the Mouse. Mouse Genome 94(4):880-882 |
| abstractText | Full text of Mouse Genome contribution: A GLUCOSE-6-PHOSPHATE DEHYDROGENASE (G6PD) PSEUDOGENE IN THE MOUSE. S Sanders, M Kuraguchi, GA Thomas*, ED Williams. Department of Histopathology, University of Cambridge, Level 5, Laboratory Block, Addenbrooke's Hospital, Hills Rd, Cambridge, CB2 2QQ, UK. * To whom correspondence should be addressed. INTRODUCTION To study the G6PD gene, genomic liver DNA was amplified using the PCR technique. It was found that certain primers gave rise to two products, one of which was the size expected if the template was genomic DNA, while the other was the size expected from cDNA amplification. This led to the conjecture that an intronless G6PD pseudogene existed, similar to that described for the rat (GenBank Accession Number M24284). One group has mentioned the possible existence of a mouse pseudogene (1), but gave no details and this work has not hitherto been confirmed. MATERIALS AND METHODS DNA isolation. DNA was extracted from the livers of 4 strains of mice (BALB/c, C3H, C57BL/6 and GPDX) using a standard protocol (2). The resultant pellet was dissolved in TE (pH 7.6 - 8.0; l0mM Tris, 1mM EDTA). DNA concentration and purity was determined by finding the absorbance of a 1:100 dilution of each sample at 260nm and 280nm. PCR. All primers were 20mers with a 50% GC content, and were commercially synthesised by R&D Systems and HPLC purified. The 5' primers were 5'-biotinylated to aid with sequencing. The other primers were not biotinylated. Primer sets used were A1/C2 (A1 = 5'-TATCCTACCATCTGGTGGCT; C2 = 5' TTGGTGGAAGATGTCACCTG) and H1/B2 (H1 = 5' AAGAGACCTGCATGAGTCAG; B2 = 5'- GCTGCCATATACATAGGGGA). A total reaction volume of 50ul was used: 2-3ul cDNA, 5ul of each of the two primers (2uM), 5ul 10x Buffer (Promega; 500mM KC1, 15mM MgCl2, 100mM Tris-HCl, ph 9.0 and 1.0% Triton X-100), 5ul 2mM dNTPs, 0.5ul Taq (Promega, 5u/ul), made up to 50ul with water. All samples were covered with a drop (~50ul) of sterile oil (Sigma). For each PCR a 'no DNA' control was included. A 'false' hot start at 80 degrees C for ~15 seconds was used, followed by 35 cycles of 95 degrees C for 30 seconds, 55 degrees C for 60 seconds and 72 degrees C for 2 minutes. A final step of 5 minutes at 72 degrees C was used to allow for completion of partial polymerisation products. After cycling was complete, samples were removed from under oil and stored at Ð20 degrees C. Products were checked by running on a 1.5% agarose gel at a constant 50V for 45 minutes. Loading buffer (xylene cyanol and bromophenol blue; 0.5u1) was added to 4ul of sample and the entire 4.5ul was loaded onto the gel. If products of the correct size were seen, the rest of the PCR sample was run on a 1.5% low melting point (LMP) agarose gel for 2-3 hours at 30V and at room temperature. Approximately 45ul of sample plus 2ul loading buffer (with xylene cyanol only) was loaded per lane. The resulting bands were visualised with ethidium bromide, cut out quickly and carefully under UV light and the gel pieces melted in a 70 degree C water bath for 2-3 minutes. DNA was then extracted using a Promega Wizard Mini-Prep Kit (Promega, UK), and the final product extracted for 5 minutes with 50ul TE (pH 8.0; 10mM Tris, 1mM EDTA). The extract was checked on a 1.5% agarose gel as described above before it was sequenced. Sequencing PCR was performed with biotinylated 5' primers. This allowed the PCR product to be manipulated using Dynal M-280 streptavidin beads and a Dynal Magnetic Particle Concentrator (MPC), following the protocols supplied with the product. For the direct sequencing reaction, the protocol supplied with the SequenaseTM Version 2.0 DNA Sequencing kit (United States Biochemical, Ohio, USA) was followed. Samples were run on a 40cm 6% polyacrylamide sequencing gel with 42% urea for between 1.5 and 5.5 hours at a constant 40W, dried under vacuum and exposed for between 1 and 7 days with Fuji RX X-ray film. RESULTS AND DISCUSSION We have confirmed the existence of a mouse G6PD pseudogene, studied its sequence in four different mouse strains (BALB/c, C3H, C57BL/6 and GPDX), and compared this to the G6PD cDNA sequence from the same four strains. The portion of the pseudogene corresponding to exons 4 to 12 of the G6PD gene was sequenced (Figure 1). This region covers both the glucose-6-phosphate (G6P) binding site (3, 4) and the putative NADP binding site (5). The G6PD gene cDNA sequence used for comparison has been examined in 3 of the 4 strains of mouse (BALB/c, C3H and GPDX; top line, Figure 1) and was found to be identical with the published sequence (C57BL/6) (6), except at a single base (nucleotide 718) which represents a silent mutation (GGC to GGA, both coding for the amino acid glycine) found only in the C57BL/6 strain. In the region of the pseudogene examined, three of the strains (BALB/c, C3H and GPDX) show complete identity with each other, and differ from the G6PD cDNA sequence at 73 out of 1257 bases, representing a 94.19% homology (Figure 1). Of these differences, 70 were single base changes, 2 were single base deletions, and 1 was a single base insertion. The pseudogene sequence of the C57BL/6 strain differed from the other three strains at 5 bases and from the G6PD cDNA at 72 bases out of 1257 (94.27% homology). Of the 5 bases that were different in the C57BL/6 strain, 3 were the same as the G6PD cDNA sequence, while 2 were differences unique to this strain. The fact that the homology between the pseudogenes from all mouse strains examined and the true coding G6PD gene sequence is >90%, and that the sequence is intronless, suggests that the pseudogene was derived originally from rnRNA, which could have been reverse transcribed and inserted back into the genome by a retroviral vector. It could be argued that this gene may be transcribed and processed, but not translated. However, various data contradict this. Sequencing of cDNA derived from liver mRNA yielded only a single sequence identical to the published cDNA sequence from the BALB/c strain (6) (GenBank Accession Number Z11911). In addition, the double bands found on PCR of genomic DNA using primers in the coding region of the gene were not present in any of the mice studied when primers specific to the non-coding promoter region were used. When this region was sequenced in 9 different mice from 5 different strains, only a single, unique sequence with almost complete sequence identity with that published (GenBank Accession Number X53617) was obtained, and with no degeneracy in the ~1400 base pairs sequenced (data not shown). This suggests that the pseudogene has no promoter and is therefore not transcribed. There is the possibility that the primers would not pick up the pseudogene promoter if its sequence differed significantly from that of the published sequence, but we feel that this is unlikely considering the large number of primers used in that area (6 different pairs) and the high degree of homology between the large sequenced portion of the pseudogene and the G6PD gene. Three of the points at which the pseudogenes in all strains examined differ from the true cDNA sequence represent frameshift mutations (Figure 1). The first, an insertion after base 328 in the cDNA sequence, would result in a stop codon at bases 363-365 (amino acid 105) of the cDNA sequence. Therefore, even if the pseudogene were transcribed it would not produce an active protein. Comparison of the C57BL/6 pseudogene sequence with that of the other three strains examined provides some interesting information. The fact that 3 of the 4 bases at which the C57BL/6 pseudogene sequence differs from the other 3 strains are the same as the true G6PD cDNA sequence, implies that the orginal mouse strain diverged and gave rise to the C57BL/6 ancestor and an ancestor common to all of the other three strains (BALB/c, C3H and GDPX), which then diverged at a later time. This is in keeping with the phylogeny of these strains (7). We therefore conclude that we have demonstrated the presence of a murine G6PD pseudogene. It is important to take into account the existence of this pseudogene in any studies on this gene in the mouse. Also, comparison of the mouse and rat true and pseudogene sequences provides a means by which to study, in the same gene, the intra- and interspecies mutation rates, as well as giving information on the time of divergence of the two species. Acknowledgements This work has been supported by grants from the Wellcome Trust (SS), the MRC (MK) and the BBSRC (GAT). Figure 1 (Legend) Comparison of mouse G6PD cDNA sequence (top line) with mouse G6PD pseudogene from 3 strains (BALB/c, C3H and GPDX, middle line) and from C57BL/6 (bottom line). Numbering for mouse cDNA is as for the published sequence (6). Key: bold = base difference in pseudogene compared to cDNA, bold underlined = base difference unique to C57BL/6 compared to cDNA, italicised underlined = base in C57BL/6 same as cDNA, but different from other 3 strains. The ATG start and TGA stop codons are underlined. REFERENCES (1) Toniolo, D., Filippi, M., Dono, R., Lettieri, T., Martini, G., (1991). Gene 102, 197-203. (2) Sambrook, J., Fritsch, E.F., Maniatis, T., Molecular cloning: A laboratory manual. C. Nolan, Eds., (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989), vol. 3. (3) Camardella, L., Caruso, C., Rutigliano, B., Romano, M., Di Prosco, G., Descalzi-Cancedda, F., (1988). European Journal of Biochemistry 171, 485-489. (4) Beutler, E., (1994). Blood 84, 3613-3636. (5) Hirono, A,, Kuhl, W., Gelbart, T., Forman, L., Fairbanks, V.F., Beutler, E., (1989). Proceedings of the National Academy of Sciences, USA 86, 10015-10017. (6) Zollo, M., D'Urso, M., Schlessinger, D., Chen, E.Y., (1993). DNA Sequence 3, 319-322. (7) Festing, M.F.W, in Inbred strains in biochemical research M.F.W. Festing, Eds. (MacMillan Press Ltd., London, 1979) pp. 137-141, 152-157, 168-183. |
