| Primary Identifier | MGI:6780038 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dnah10 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 mediated recombination using 2 guide RNAs (sgRNA-1: ATCTTATGCTGGGTCCAGTAAGG, sgRNA-2: TTTATAACAAATGGCTTGATTGG) deleted a genomic region spanning exons 2 - 5. Immunostaining confirmed the absence of protein expression in testes and spermatozoa from homozygous mice. |
