| Primary Identifier | MGI:7734987 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, Reporter | Gene | Gt(ROSA)26Sor |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were used to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a loxP-flanked STOP cassette, residues 2-118 of the human transferrin receptor (TFRC) fused to residues 139-387 of the ovalbumin gene, a bovine growth hormone polyadenylation signal (bGHpolyA), a 2A self-cleaving peptide and luciferase gene into the Gt(ROSA)26Sor locus on Chromosome 6. The sgRNAs, ssDNA (repair template), and the cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J. |
