| Primary Identifier | MGI:8164186 | Allele Type | Endonuclease-mediated |
| Attribute String | Inserted expressed sequence | Gene | Gt(ROSA)26Sor |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | gRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert an albumin (Alb) promoter, followed by a Kozak sequence, and a 2.4-kbp mouse/human hybrid plasminogen (Plg/PLG) cDNA with a bGH poly(A) sequence targeted to Gt(ROSA)26Sor locus. Specifically, the (Plg/PLG) cDNA sequence includes the mouse Plg (mPg), consisting of 2 amino acid changes in exon 7 of the kringle-2 (K2) domain (G239R and P241L) in the heavy chain of mPg and a complete replacement of the mPg light chain with the human PLG (hPG) light chain. The mPg cDNA includes the coding sequence from the ATG start code in exon 1 to the end of the heavy chain in exon 13. |
