|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em1(Alb-Plg*/PLG)Vlp> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Victoria A Ploplis
Primary Identifier  MGI:8164186 Allele Type  Endonuclease-mediated
Attribute String  Inserted expressed sequence Gene  Gt(ROSA)26Sor
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  gRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert an albumin (Alb) promoter, followed by a Kozak sequence, and a 2.4-kbp mouse/human hybrid plasminogen (Plg/PLG) cDNA with a bGH poly(A) sequence targeted to Gt(ROSA)26Sor locus. Specifically, the (Plg/PLG) cDNA sequence includes the mouse Plg (mPg), consisting of 2 amino acid changes in exon 7 of the kringle-2 (K2) domain (G239R and P241L) in the heavy chain of mPg and a complete replacement of the mPg light chain with the human PLG (hPG) light chain. The mPg cDNA includes the coding sequence from the ATG start code in exon 1 to the end of the heavy chain in exon 13.
  • mutations:
  • Insertion
  • synonyms:
  • ROSA26-mhPG,
  • ROSA26-mhPG
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

2 Expresses

Trail: Allele

0 Mutation Involves

Phenotype

Mouse alleles --> Genotypes/models

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

1 Driven By

Trail: Allele

2 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom