| Primary Identifier | MGI:8189955 | Allele Type | Endonuclease-mediated |
| Attribute String | Recombinase | Gene | Cntn2 |
| Strain of Origin | C57BL/6 | Induced With | tamoxifen |
| Is Recombinase | true | Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (AGCGTTGAGATCAGAGCCTCTGG) was used to introduce a cre/ERT2 fusion gene (a Cre recombinase fused to a human estrogen receptor ligand binding domain) fused to a P2A self-cleaving peptide downstream of exon 23 of the contactin 2 (Cntn2) gene. |
