| Primary Identifier | MGI:8280677 | Allele Type | Endonuclease-mediated |
| Attribute String | Inserted expressed sequence | Gene | Gt(ROSA)26Sor |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9-mediated recombination inserted a FLExZfp768 cassette composed of the Zfp768 coding sequence (NCBI Reference Sequence NM_146202.1, nucleotide 79 to 1785) in the antisense orientation with the Kozak sequence located upstream of the start codon. This sequence is flanked by two pairs of heterologous Cre recognition sites (LoxP and Lox2272) in the opposite direction with an alternate order at both ends of the transgene. The Zfp768 sequence is preceded by a cytomegalovirus (CMV) early enhancer/chicken ���� actin (CAG) promoter and followed by a polyA sequence. A guide RNA (gRNA) previously reported to be efficient for editing the mouse Gt(ROSA)26Sor locus was chosen to insert the FLExZnf768 cassette. The sequence of this gRNA, localized on chr6:113,076,040������113,076,05 GRCm38/mm10, is ACTGGAGTTGCAGATCACGA (with PAM motif GGG). As a template for homologous directed recombination, the FLExZfp768 cassette was flanked by standard Gt(ROSA)26Sor homology regions extending 300 bp upstream and downstream of the CRISPR-Cas9 cut site. Cre-mediated inverted the Zfp768 sequence allowing for constitutive expression. |
