| Primary Identifier | MGI:8272191 | Allele Type | Endonuclease-mediated |
| Gene | Scn9a | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Tyrosine codon 1546 (TAC) was changed to serine (TCA) (p.Y1546S), tryptophan codon 1547 (TGG) to arginine (CGG) (p.W1547R) and valine codon 1550 (GTG) to leucine (CTG) (p.V1550L) using an sgRNA (targeting TGTGCTATACTGGATCAACG) and an ssODN template with CRISPR/Cas9 technology. The mutations, in the aryl-sulfonamide-binding site of the encoded protein, reduce SCN9A binding to its agonist GNE-3565 by more than 100-fold. |
