| Primary Identifier | MGI:8420514 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Alpk2 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/Cas9-mediated recombination generated a 31-bp deletion (CAAGCCAGAGGTGACTTGGTATAAGAATGGT) in exon 3, resulting in a premature stop codon immediately at the targeting site. RT-PCR using primers designed to bind exons flanking the crRNA targeting site confirmed the deletion and did not detect possible alternative splicing that could have resulted in the expression of a functional ALPK2 isoform. |
