| Primary Identifier | MGI:8404123 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, Epitope tag, Inserted expressed sequence | Gene | Gt(ROSA)26Sor |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 technology, gRNA (ACTCCAGTCTTTCTAGAAGATGG), the targeting vector was designed based on Ai65 with (from 5' to 3') a chicken beta-actin (CAG) promoter, a frt-flanked STOP cassette (with polyA translational stops in all three reading frames), a loxP-flanked STOP cassette (with stop codons in all three reading frames linked to three repeats of the SV40 polyA signal), a sequence encoding flag-tagged human B cell leukemia/lymphoma 2 (BCL2) cDNA, and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE; to enhance the mRNA transcript stability) targeted to the Gt(ROSA)26Sor locus. The targeting vector contains a neo cassette and remains in this allele. |
