| Primary Identifier | MGI:8403692 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Fgfr3 |
| Transmission | Germline | Strain of Origin | C57BL/6NSlc-Tg(CAG-EGFP,Acr-EGFP)2Osb |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/Cas9-mediated recombination using gRNA 5������ TACGCAGGCGTCCTCAGCTA 3������ introduced a G to A change at position 1120 (c.1120G>A) resulting in a glycine to arginine substitution at amino acid 374 (p.Gly374Arg) in exon 9. This is the most common mutation in achondroplasia patients. An FRT-flanked neomycin resistance cassette was inserted and removed via flp-mediated recombination. In addition, c.1107C>A, c.1110C>A, and c.1113C>G mutations were introduced to prevent the cleavage of the alleles and vectors and established a Sca1 site without changing the amino acid sequence. |
