|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<tm7.1(CAG-EGFP/RNAi:Tyr)Maoh> gene trap ROSA 26, Philippe Soriano; targeted mutation 7.1, Masato Ohtsuka
Primary Identifier  MGI:5056538 Allele Type  Targeted
Attribute String  Conditional ready, Knockdown, Reporter, RMCE-ready Gene  Gt(ROSA)26Sor
Transmission  Germline Strain of Origin  129P2/OlaHsd
Is Recombinase  false Is Wild Type  false
molecularNote  Recombinase-mediated cassette exchange (RMCE) replaced the expression cassette between the JT15 and lox2272 sites of Gt(ROSA)26Sortm1Maoh with (5' to 3') an IRES, lacZ, polyadenylation sequence, CAG promoter, hygro gene, polyadenylation sequence, FRT site, polyadenylation sequence, and CAG driven fusion of EGFP and a short hairpin RNA targeted to Tyrosinase. The RNAi target sequences within the Tyr gene are "ctggaaggatttgccagtccac"and "gaactgccaatttcagcttta". Flp-mediated recombination removes all but the CAG promoter RNAi construct flanked by an FRT site and the lox2272 site.
  • mutations:
  • Insertion
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Genome

0 Expresses

1 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories





MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom