|  Help  |  About  |  Contact Us

Allele : Fastkd5<em1(IMPC)J> FAST kinase domains 5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5607864 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fastkd5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Fastkd5-6053J-P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTGGTATGCCGAAGATTTAC, which resulted in a 14 bp deletion TGCCGAAGATTTAC in exon2 beginning at Chromosome 2 negative strand position 130,616,640 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 21 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Fastkd5<em1J>,
  • Fastkd5<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories