| Primary Identifier | MGI:5607864 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fastkd5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Fastkd5-6053J-P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTGGTATGCCGAAGATTTAC, which resulted in a 14 bp deletion TGCCGAAGATTTAC in exon2 beginning at Chromosome 2 negative strand position 130,616,640 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 21 amino acids later. |
