|  Help  |  About  |  Contact Us

Allele : Adad1<em1(IMPC)J> adenosine deaminase domain containing 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5616653 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Adad1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Adad1-6098-103P6MR was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CTTTCAGAGGAATATCCAGT and AAGTTGTAGTCTGTCGAATA, which resulted in a 29 bp deletion ATATTCCTCTGAAAGTTGTAGTCTGTCGA in exon 2 beginning at Chromosome 3 positive strand approximate position 37,064,302 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 81 and an early truncation 9 amino acid later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Adad1<em1J>,
  • Adad1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories