| Primary Identifier | MGI:5620213 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ddx59 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ddx59-6150J-MP92R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCAGCAAGTGCTTGACGTTT, which resulted in an 8 bp deletion TTGACGTT in exon 5 beginning at Chromosome 1 positive strand position 136432352bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 368 and early truncation 5 amino acids later. |
