|  Help  |  About  |  Contact Us

Allele : Ddx59<em1(IMPC)J> DEAD box helicase 59; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5620213 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ddx59
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ddx59-6150J-MP92R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCAGCAAGTGCTTGACGTTT, which resulted in an 8 bp deletion TTGACGTT in exon 5 beginning at Chromosome 1 positive strand position 136432352bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 368 and early truncation 5 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ddx59<->,
  • Ddx59<->,
  • Ddx59<em1J>,
  • Ddx59<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele