|  Help  |  About  |  Contact Us

Allele : Dnase1l2<em1(IMPC)J> deoxyribonuclease 1-like 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5638888 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dnase1l2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dnase1l2-6639J-M2859 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ex3.g1-GGCCGGCTATGATATCGCCC, int2.g1- GGCAATTAGGCTGATTGGGA, and int3.g1- TTGGTTCGGTGCCTTGACCC, which resulted in a 198bp deletion beginning in intron 2 at CTGATTGGGACGGTGCATCTGTGGG Chromosome 17 negative strand position 24,442,529 bp (GRCm38) and ending after GGTGCCTTGACCCAGGGACTGG at position 24,442,332 bp in intron 3. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 48 and early truncation 16 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Dnase1l2<em1J>,
  • Dnase1l2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories