| Primary Identifier | MGI:5638892 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Orc6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Orc6-6540J-8033M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CATCTGTTCAGCAGTAAATG, AACTGCATCCGGTGTGAAAA and TACTAAACCACTTTATTCGC (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 435bp deletion beginning in intron 4 at CTCATTTACTGCTGAACAGATGAA at Chromosome 8 positive strand position 85,305,411 bp (GRCm38) and ending after CTGCGAATAAAGTGGTTTAGTAC at position 85,305,411 bp in intron 5. This mutation deletes exon 5 and is predicted to cause amino acid sequence changes after residue 150 and early truncation 6 amino acids later. PCR failed to detect the insertion of any loxP sites. |