|  Help  |  About  |  Contact Us

Allele : Nadk2<em1(IMPC)J> NAD kinase 2, mitochondrial; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5689888 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nadk2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, TTACGGTAAGTCCAAGCGAT and TTGAAAGGCTCGAGCTACAG, which resulted in a 94 bp deletion beginning in exon 2 at Chromosome 15 position 9,083,375 bp, CCATCGCTTGGACTTACCGTA, and ending after GTAGTCCACTGTAGCTCGAGCC at 9,083,282 bp (GRCm38/mm10) in intron 2. This 94 bp deletion begins after the initial 12 bp of coding sequence of exon 2 and includes 77 bp of exon 2 then 17 bp of intron 2 including the splice donor sequence, and is predicted to cause a read-through into intron 2, which results in amino acid sequence changes after amino acid 92 and early truncation 18 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Nadk2<em1J>,
  • Nadk2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories