|  Help  |  About  |  Contact Us

Allele : Arhgap29<em1(IMPC)J> Rho GTPase activating protein 29; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5749747 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arhgap29
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Arhgap29-7394J-F2209 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTGCTTCAAAGCACAAAG, AGATCAGTTGCAGTAAGTGG, TGTACGGTACATGAATCTGC, and ACATGAATCTGCGGGATAAA, which resulted in a 274 bp deletion spanning exon 4 beginning at Chromosome 3 positive strand position 121,988,385 bp, TTTGTGCTTTGAAGCAATGGTG, and ending after TACGGTACATGAATCTGCGG at 121,988,658 bp (GRCm38/mm10). There is a 36 bp insertion in the intron that will not affect the exon deletion. This mutation deletes exon 4 and 177 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 114 and early truncation 8 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Arhgap29<em1J>,
  • Arhgap29<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories