| Primary Identifier | MGI:5749747 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arhgap29 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Arhgap29-7394J-F2209 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTGCTTCAAAGCACAAAG, AGATCAGTTGCAGTAAGTGG, TGTACGGTACATGAATCTGC, and ACATGAATCTGCGGGATAAA, which resulted in a 274 bp deletion spanning exon 4 beginning at Chromosome 3 positive strand position 121,988,385 bp, TTTGTGCTTTGAAGCAATGGTG, and ending after TACGGTACATGAATCTGCGG at 121,988,658 bp (GRCm38/mm10). There is a 36 bp insertion in the intron that will not affect the exon deletion. This mutation deletes exon 4 and 177 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 114 and early truncation 8 amino acids later. |