| Primary Identifier | MGI:5754603 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | L3mbtl3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0370 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TCCAAGATTGACGTGTAGAT and GAAGGCACTACATCTAATGC. This resulted in a 734 bp deletion from Chr10:26342355 to 26343088 in ENSMUSE00000309524 (GRCm38). |
