| Primary Identifier | MGI:5755486 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dctn6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Dctn6-7440J-F5820 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCAAACTGGACGGCACG, CCTGGGCAGCGGCCGATGTT, AGTGCCAGACCTACAGCCGA, and GCTGCACTTCCAGCAGGAGG, which resulted in a 348 bp deletion spanning exon 4 beginning at Chromosome 8 negative strand position 34,097,481 bp, CTGTAGGTCTGGCACTAACT, and ending after GGAAGGTTTCCCAACATCGG at 34,097,134 bp (GRCm38/mm10). This mutation deletes exon 4 and 259 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 65 and early truncation 9 amino acids later. |