|  Help  |  About  |  Contact Us

Allele : Dctn6<em1(IMPC)J> dynactin 6; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755486 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dctn6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dctn6-7440J-F5820 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCAAACTGGACGGCACG, CCTGGGCAGCGGCCGATGTT, AGTGCCAGACCTACAGCCGA, and GCTGCACTTCCAGCAGGAGG, which resulted in a 348 bp deletion spanning exon 4 beginning at Chromosome 8 negative strand position 34,097,481 bp, CTGTAGGTCTGGCACTAACT, and ending after GGAAGGTTTCCCAACATCGG at 34,097,134 bp (GRCm38/mm10). This mutation deletes exon 4 and 259 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 65 and early truncation 9 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Dctn6<->,
  • Dctn6<->,
  • Dctn6<em1J>,
  • Dctn6<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele