|  Help  |  About  |  Contact Us

Allele : Thoc6<em5(IMPC)Tcp> THO complex 6; endonuclease-mediated mutation 5, The Centre for Phenogenomics

Primary Identifier  MGI:5755089 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Thoc6
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0363, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GGTCATGTGCAGTCGCTGCA and GCTGCCAGAAACTTCCCGCA. This resulted in a 17 bp deletion from Chr17:23670837 to 23670853 in OTTMUSE00000307828. This mutation is predicted to cause a frameshift with amino acid changes after residue 34 and early truncation 35 amino acids later (p.P34Gfs*37). (GRCm38).
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories