| Primary Identifier | MGI:5755089 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Thoc6 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele, from project TCPR0363, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GGTCATGTGCAGTCGCTGCA and GCTGCCAGAAACTTCCCGCA. This resulted in a 17 bp deletion from Chr17:23670837 to 23670853 in OTTMUSE00000307828. This mutation is predicted to cause a frameshift with amino acid changes after residue 34 and early truncation 35 amino acids later (p.P34Gfs*37). (GRCm38). |