| Primary Identifier | MGI:5775775 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wdfy4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Wdyf4-7724J-M9881 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTCTATGAGGAAAGGGGAC, CAGGCCTCGAAGGTGTTCCC, CATGTAGCCTTGAGGTACAT and GTTTTGGGAGCTGCGTGGAT, which resulted in a 249 bp deletion spanning exon 4 beginning at Chromosome 14 negative strand position 33,154,162 bp, CTGCGTGGATAGGATGCATC, and ending after CCTGTCCCCTTTCCTCATAG at 33,153,914 bp (GRCm38/mm10). This mutation deletes exon 4 and 142 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 30 amino acids later. |
