| Primary Identifier | MGI:5789880 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gas7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Gas7-7889J-F7372 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGCAACCCTGGGATGAGGA, CATGTGGCAGGGCCATCTAT, TAACAGTTCCTAATGATAGA and CTATTAGTGGAAAGAATCTC, which resulted in a 320 bp deletion beginning at Chromosome 11 negative strand position 67,643,151 bp GATGGCCCTGCCACATGAGA, and ending after CTGCTATTAGTGGAAAGAAT at 67,643,470 bp (GRCm38/mm10). This mutation deletes exon 4 and 234 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 31 amino acids later. |