| Primary Identifier | MGI:5812878 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Greb1l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Greb1l-8129J-M9444 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATTCTGCTGAGTTAAGAGG, ACTGGGCACTAACCACACAG, ACTGGGAATAAGTTACCAAT and GCCTTTACACCATGACTAAA, which resulted in a 512 bp deletion beginning at Chromosome 18 positive strand position 10,521,878 bp, AGTCTGACGTTTCCTCCTCT, and ending after TTGGTGTCTTCCCATTGGTA at 10,522,389 bp (GRCm38/mm10). This mutation deletes exon 16 and 331 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 42 bp insertion at the deletion site as well as a 2 bp (AC) deletion 90 bp before the insertion/deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 727 and early truncation 1 amino acid later. |
