|  Help  |  About  |  Contact Us

Allele : Apmap<em1(IMPC)J> adipocyte plasma membrane associated protein; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5825060 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Apmap
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Apmap-8259J-M2499 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTACACAGCTCCCAGACAG, GTTGCCACTGTTGCTCAGGG, CCATACCGCAGACATCCTGA and AACTGTCTTGAGGCCATGGG, which resulted in a 434 bp deletion beginning at Chromosome 2 negative strand position 150,594,667 bp, GTGATGAGACCGTCAGGATG, and ending after TGCCACTGTTGCTCAGGGTG at 150,594,234 bp (GRCm38/mm10). This mutation deletes exon 3 and 318 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 1 bp insertion 43 bases before the deletion that will not affect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 69 and early truncation 15 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Apmap<em1J>,
  • Apmap<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories