| Primary Identifier | MGI:5903750 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dusp22 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Dusp22-8513J-1842M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCCTGCTCCTAAGTGCAGG, CATGTTTGCCAAGGCCGTGA, CACTCAAACCCCAAGTCACA and CCCTGGCAATACCTTTTTGA, which resulted in a 490 bp deletion beginning at Chromosome 13 positive strand position 30,668,607 bp, GCAGGGGGTTGAAAGATTAC, and ending after TACCCTGGCAATACCTTTTT at 30,669,096 bp (GRCm38/mm10). This mutation deletes exon 2 and 456 bp of flanking intronic sequence including the splice acceptor and donor. In addition 71 bp upstream of the 490 bp deletion there is a deletion of 78 bp (Chr:13 30,668,458 bp - 30,668,535 bp) of intronic sequence that was replaced with 73 bp, the majority of which derived from the opposite strand of the excised sequence that reinserted in reverse orientation and should not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 7 and early truncation 7 amino acids later. |