| Primary Identifier | MGI:5903080 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Asmt |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Asmt-8570J-1754F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGCCCCGCCCCATCCCCA, GGAGTGACGTCATCGGGGGC, GTGAAGCCCCGCCCACGGCG and CGTGACCTTTGACCTTCAGT, which resulted in a 405 bp deletion beginning at Chromosome X positive strand position 170,674,525 bp, GCCCCCGATGACGTCACTCC, and ending after GTGTTAGCGGGGTGGGCGGG at 170,674,929 bp (GRCm38/mm10). This mutation deletes exon 3 and 272 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (T) and a 4 bp deletion (CTGG) 165 bp before the 405 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 87 and early truncation 199 amino acids later. |