|  Help  |  About  |  Contact Us

Allele : Asmt<em1(IMPC)J> acetylserotonin O-methyltransferase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5903080 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Asmt
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Asmt-8570J-1754F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGCCCCGCCCCATCCCCA, GGAGTGACGTCATCGGGGGC, GTGAAGCCCCGCCCACGGCG and CGTGACCTTTGACCTTCAGT, which resulted in a 405 bp deletion beginning at Chromosome X positive strand position 170,674,525 bp, GCCCCCGATGACGTCACTCC, and ending after GTGTTAGCGGGGTGGGCGGG at 170,674,929 bp (GRCm38/mm10). This mutation deletes exon 3 and 272 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (T) and a 4 bp deletion (CTGG) 165 bp before the 405 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 87 and early truncation 199 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories