|  Help  |  About  |  Contact Us

Allele : Dgkb<em1(IMPC)J> diacylglycerol kinase, beta; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5903234 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dgkb
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dgkb-8572J-5198M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTAGATGTTTCTATCTCCA, AAGATGAAGCCAAGGCTTAG, ATGTCTCTAGCAAAATAAGT and GGATACTGGATACTCTATAA, which resulted in a 566 bp deletion beginning at Chromosome 12 positive strand position 38,100,137 bp, GGAGATAGAAACATCTAACT, and ending after AGTAGGGTAGAAAATAGTAT at 38,100,702 bp (GRCm38/mm10). This mutation deletes exon 4 and 412 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories