|  Help  |  About  |  Contact Us

Allele : Exoc2<em1(IMPC)J> exocyst complex component 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5909206 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Exoc2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTAAAATTAAAGAACCAAA, ATATTTAGGGATATCCCACAand GTATTTGTTATAAGGCCAGC, which resulted in a 346 bp deletion beginning at Chromosome 13 negative strand position 30,935,755 bp ATTTGTTATAAGGCCAGCAG, and ending after CATATTTAGGGATATCCCAC at 30,935,410 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117295 (exon 4) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 8 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Exoc2<->,
  • Exoc2<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories