|  Help  |  About  |  Contact Us

Allele : Rnf40<em1(IMPC)J> ring finger protein 40; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6158667 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rnf40
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACTCAGACACATCACAC, CTGAGAACATAAGCTCCCCA, GGACAAGGATTAGACTGAAA and TGTGGGGCTACCGAAATGCC, which resulted in a 593 bp deletion beginning at Chromosome 7 position 127,589,325 bp and ending after 127,589,917 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000203766 and ENSMUSE00000203748 (exons 3 and 4) and 283 bp of flanking intronic sequence including the splice acceptor and donor. There is a 3 bp (TAC) retention 95 bp (7:127589325-127589419) after the beginning of the 593 bp deletion followed by 495 bp of additional deleted sequence. In addition, 56 bp after the deletion there is a 7 bp insertion (CACATCA) and a 19 bp deletion (GAAATGCCCGGCACTTGGG), that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 44 and early truncation 85 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories