| Primary Identifier | MGI:6158667 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf40 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACTCAGACACATCACAC, CTGAGAACATAAGCTCCCCA, GGACAAGGATTAGACTGAAA and TGTGGGGCTACCGAAATGCC, which resulted in a 593 bp deletion beginning at Chromosome 7 position 127,589,325 bp and ending after 127,589,917 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000203766 and ENSMUSE00000203748 (exons 3 and 4) and 283 bp of flanking intronic sequence including the splice acceptor and donor. There is a 3 bp (TAC) retention 95 bp (7:127589325-127589419) after the beginning of the 593 bp deletion followed by 495 bp of additional deleted sequence. In addition, 56 bp after the deletion there is a 7 bp insertion (CACATCA) and a 19 bp deletion (GAAATGCCCGGCACTTGGG), that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 44 and early truncation 85 amino acids later. |
