| Primary Identifier | MGI:6101191 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttll7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAAAACACAGCACTTGCAGA, ACAGTGTTCCAGGTGCAGAC, CCAGCGAGCAACGAGACAGG and ACACCTTAAGATGAGTGACA, which resulted in a 500 bp deletion beginning at Chromosome 3 positive strand position 146,896,502 bp and ending after 146,897,001 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224812 (exon 4) and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 5 bp deletion (CTCTG) 138 bp before the 500 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 52 and early truncation 12 amino acids later. |