|  Help  |  About  |  Contact Us

Allele : Ttll7<em1(IMPC)J> tubulin tyrosine ligase-like family, member 7; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6101191 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ttll7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAAAACACAGCACTTGCAGA, ACAGTGTTCCAGGTGCAGAC, CCAGCGAGCAACGAGACAGG and ACACCTTAAGATGAGTGACA, which resulted in a 500 bp deletion beginning at Chromosome 3 positive strand position 146,896,502 bp and ending after 146,897,001 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224812 (exon 4) and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 5 bp deletion (CTCTG) 138 bp before the 500 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 52 and early truncation 12 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele